SHIFT Update 1/4

Jada Privat

Das erste Trinity Triple ist geschafft. Welch eine hervorragende Neuigkeit nach der stürmischen Navigation durch die Tiefen des inneren Universums.

Betrachtet man die vergangenen Wochen im letzten Part (Universalmonat 15) des ersten der vier Triples, haben sich seit dem letzten NM – besonders auch durch den rückwärts wandernden Merkur – die unterschiedlich individuellen Situationen verschärft und an VM (im Haus der Waage – regiert das 7. Haus der engen/intimen Beziehungen) abermals das Veränderungspotenzial intensiviert. Kaum jemand war verschont bleierne, schmerzhafte Zustände in Physis oder Psyche im innen oder außen zu erfahren. Abtrennung/Verluste war die Losung der vergangenen Monate.

Tief in euren, unser aller Herzen wisst ihr jedoch, dass Erfahrung und Interaktionen von Verlust und Verwirrung höchst unangenehm, aber nur Ursache für Verschiebung in Richtung höchst heiliger Absicht aller Seelenlichter ist.

2019 ist Rekonfiguration des Kern, der neuen Realität. Leben- Tod- Wiedergeburt, Galaktisches Zentrum- Alcyone (weibl. Archetypus) – Sirius (männl. Archetypus), Sonne – Mond – Erde, Vergangenheit- Gegenwart- Zukunft.

In meinem Umfeld begann dieser Prozess schon Wochen vor Weihnachten, wo einige sehr nahe stehende Wesen das Regenbogenportal durchwanderten. Und trotz des absoluten Wissens wurde eine lange Phase des Rückzuges für meine und die meiner Familie individuelle Trauerbewältigung eingeleitet. Noch nicht ganz in diesem Raum angekommen oder zurechtfindend kam der nächste Paukenschlag Punkt Mitternacht zum Jahreswechsel. Es war zwar im Vergleich ein lapidarer materieller Schaden aber beeindruckte durch die Feiertage und der Jahreszeit entsprechenden Kälte auch mein Gemüt. Trotz all diesen vielen Ereignissen war die Liebe in unserem Himmel verankert, nichts in unserem Multiversum passiert taumelnd oder unkontrolliert sondern hat immer Sinn.

In meinem Haus wurde so gezielt die Kraft des Mind, die Mentalkraft ins unermessliche gestärkt um genau zu einem bestimmten Punkt (ab 20/3- für alle, Ausrichtung Nullenergie um neuen Raum zu erklimmen ) das Leuchtfeuer und den dazugehörigen Löschzauberschaum zu aktivieren.

Es gibt viele, viele Seelengeschichten die im ersten Moment eine Tragik anzeigen, doch bei genauerer Beleuchtung den königlichen Pfad einer großen (hinter den Schleiern) laufenden Veränderungen freilegt.

Mit 29/3 hat sich Merkur wieder der Vorwärtsbewegung bei 16°/7 in Fisch zugewandt – ein wahrer Segen nach den vielen Tiefsee – Tauchgängen und doch gehen alle mit auf diese große Transformationsreise. Jetzt geht es darum wie stellen wir es an, alle daran ohne größere Verluste teilhaben zu lassen (größere Verluste= neues Karma zu kreieren). Glaube, Hoffnung, Mitgefühl das große Gesamte zu erkennen. Es mag leichter erscheinen als es tatsächlich ist, sich selbst immer wieder dabei zu erwischen. Sich Selbst nicht als Mittelpunkt des großen Ganzen zu sehen und sich primär zu behandeln, sondern dass parallel alles ständig an Verbindung/Verwebung gekoppelt ist.

Damit hat zwei Tage vor Beginn ersten Triple im zweiten Trinity Monat eine großartig, wirklich grandiose 8 wöchige Vibration voller frischer Energie des absoluten Neuanfangs begonnen.

Die erste Woche im himmlischen April hat es allerdings noch in sich, die Balken der Weichen zur Ausrichtung der Flugroute sind noch nicht fertig geölt und knatschen noch mächtig.

Andromeda ist das begleitende System im Monat der Ausrichtung zwischen Licht und Dunkel. Wesen dieses Systems und wir Erdlinge sind uns sehr ähnlich.

Das Karma erfährt damit wieder an Aufmerksamkeit, Missstände vergangener Leben , die Schattenseiten unser aller Selbst schwappen an die Oberfläche, werden mit Pluto im südl. Mondknoten Transformation und Reinigung/Klärung vorantreiben.

Das Sternenvolk aus der Andromeda Galaxie kommt von sehr weit, um göttliche Aspekte der Heilung in der niedrigeren Dimension zu verdichten und zu verankern. Wir werden befähigt nun mit ihren Vibes allen und jedem, in allen Ebenen,  auf die Energie des Verständnis von Informationen im Bewussten Wachzustand anzunehmen und Heilung zu forcieren.

Viele Zivilisationen des Universums haben verstanden, das das Gesetz der Polarität- der gegenteiligen Entsprechung  auf unserer Ebene Karma verursacht ( Negatives produziert sich, damit Positives sich von selbst verstehen kann) und begleiten daher jeden einzelnen ganz individuell angepasst an deine Erfahrungsreise aus ihren Reichen – höchst Intuition im Monat April!!! Das Resultat ist LIEBE zu verstehen, das CHRISTUSBEWUSSTSEIN zu entfalten.

Was gibt es besseres als den April(1/4) mit einem Tag des Uranus – dem Befreier- zu starten. Loslassen und lösen/trennen in den Schichten der fein- und feststofflichen Verkörperung bleiben somit erhalten. Merkur mit Neptun tragen ihren Teil, wenn auch nicht mehr so brutal dazu bei.

Zu Beginn des zweiten Triple im Trinity des Jahreskreises in den ersten 7 Tagen ist noch mit Turbulenzen in der Aufwärtsbewegung zu rechnen. Pluto im südl. Mondknoten und Merkur, Neptun mit Venus im Haus des Fisch verschleiern die Sicht.

Herz- und Halschakra aktivieren ihre gemeinsame Verbindungsplatine.

Es kann vermehrt zu Nahrungsmittel- wie auch Ergänzungsmittel Unverträglichkeiten kommen- Ziel Ausrichtung der über 490 tRNA Gene,davon genutzt werden nur 48 Anticodons/Sorten.

Zur kurzen Erklärung:
Wir, Menschen, wissen, dass der genetische Code degeneriert ist, aber wir wissen nicht, warum das so ist. Mathematisch erklärt es sich so 4^2 < 20, also brauchen wir 4^3 usw.
Die Wirklichkeit jedoch ist, dass der offene Leserahmen/ORF mehr Informationen beinhaltet  als nur jene für die Aminosäuresequenz des codierten Proteins, und das wir alle anderen Infos noch nicht verstehen können.


Beispiel: ein Peptid hat diese Aa-Sequenz:
DASSTERNCHEN (Asp-Ala-Ser-Ile-Ser-Thr-Glu-Ile-Asn-Glu-Asn-Ser-Tyr-Met)
Dieses Peptid könnte so kodiert werden:
DNA-Sequenz1:
ATGGACGCTTCTATTTCTACTGAAATTAACGAAAACTCTTACATGTAA
GC-Gehalt = 31,3%

Oder aber auch so:
DNA-Sequenz2:
ATGGACGCCTCCATCTCCACCGAGATCAACGAGAACTCCTACATGTGA
GC-Gehalt 52,1%

Beide DNA-Sequenzen codieren das Peptid „DASSTERNCHEN“, aber neben dieser Information stecken in der DNA-Sequenz noch andere Informationen, die wir nicht kennen. Das hier mehr Information sein kann, sehen wir daran, dass die DNA-Sequenz1 und DNA-Sequenz2 sehr unterschiedlich sind; und sie haben auch unterschiedliche Eigenschaften! Welche Informationen diese DNA-Sequenzen noch beinhalten, wir Menschen sind auf der Spurensuche.

3/4 Mars/Zwilling im Sextil mit Chiron/Widder bieten perfektes Zusammenspiel zum loslassen eigener alter Muster und Strukturen.

Der Mond mit einer Erdentfernung von 397.933km wandert am 4/4 in das Haus des Widder und encodiert mit Neumond am 5/4 (MESZ 10:52:22h – 15°) eine fantastische Welle der Energie von Neuanfang (Frühlingssäfte- nördl. Hemisphäre beginnen ihren Fluss zu beschleunigen). Zu diesem Punkt werden verstärkt alte Paradigmen/Macht Strukturen versuchen ihre Grenzen auszudehnen. Wisse dabei, die Möglichkeit deine Grenzen (mit einem Wirkungsgrad von zwei Wochen) neu auszuloten besteht gleichfalls.

Dieser Beginn des Wachstums, der Ausdehnung sieht Anfangs noch ganz anders aus als zum Ende der Phase – zerstreut, irgendwie unkontrollierbar mit jeder Menge großen Lösungsmöglichkeiten- aus.

Herrscher dieses NM ist Mars/Zwilling – Visionen, Planung von Projekten werden mit Aufmerksamkeit, Konzentration und viel Raum für Detail-Verliebtheit in Materie manifestieren – Visionsboard erstellen.

Achtsamkeit, Dankbarkeit, Vertrauen und unerschütterlicher Glaube helfen alte Strukturen zu verändern.

7/4 Merkur/Fisch im Sextil Saturn/Steinbock – Ende der zementartigen bleiernen Energie der letzten zwei Wochen des 15 Universalmonats. Grandios positiv – Konzentrationssteigerung

10/4 Jupiter wird rückläufig 24° Schütze deine individuelle Arbeit steht am Prüfstand – Innehalten, sind deine Bemühungen nicht nur für das eigene Selbst sondern der Gesamtheit dienend. Diktiert dich dein Ego oder hörst du deinen Geist.

10/4 Sonne/Widder und Saturn/Steinbock überprüfe ob deine Motive mit Klarheit und Liebe gefüllt sind- beobachte niedere Energie wandert subtil.

11-12/4 einströmende Energie und ihre Auswirkung auf das große Ganze beobachten, Vorsicht bei Versprechen kann zu persönlichen Überlastung führen.

13/4 Herausforderungen mit alten Paradigmen und ihren Autoritätspersonen.

14/4 multiple gesteigerte Intuition achte auf alles was dir begegnet.

17/4 Nachschattenperiode des Merkur endet.

19/4 Vollmond in Waage die zweite – Hochspannung in Interaktion mit VM März vor allem im Feld der Beziehungen, großes Unwetterpotenzial. Mondentfernung 373.019km – Transformation und Reinigung auf Synchronitäten des Vormonats achten.

24/4 Pluto wird rückläufig bei 23°Steinbock kehrt in die Unbewussten Tiefen zurück (bis 4/10 und Saturn schließt am 29/4 die Rückwärts Wanderung an . Damit aktiviert die Vorbereitungsphase für das Multiversal Event 2020.

Zwischen 27 und 29/4 sind Konflikte mit inneren Mustern und äußeren Herausforderungen dabei an die Oberfläche zu schwappen, möchten bereinigt werden.

Generell gilt – DAS HERZ der PULS DER SCHÖPFUNG, das GALAKTISCHE HERZ, DEIN HERZ MÖCHTE HERZLICH BEHANDELT WERDEN und stärkt damit die Anbindung an die großartige GANZHEIT von allem was IST.

Portaltage 08. – 11. – 16. – 19. –

Schwendtage 19.

Freie Navigation durch den 16 Universalmonat

J.A.

In eigener Sache:

Vielen Lieben Dank und Segnungen zurück für eure Wertschätzung


19 Kommentare

  1. Danke liebe Jada
    Verstehen (kopf) oder nicht …
    das Gefühl zu Deinen Texten ist gefragt (hat MICH AUCH IN LANGER zeit herausgefordert)
    freu mich weiter auf deine Nachrichten , und danke Dir dafür
    und lass ohne kopf meinem Gefühl /Herz die info und dann ….. kommt alles an u kann wirken

    Andromeda-Galaxy hat mich sowas von emotional er-fasst – hat mit mir zu tun, ich fühle so eine freudige Verbindung, und sie wächst …. Danke Dir Du Liebe bitte schreib bitte weiter und weiter
    GLG in Liebe Andrea

    Liken

  2. Du liebe Jada,

    was hab ich mich auf und nach dem Lesen nun über dein Update gefreut!
    Herzensdank dafür!
    Ich wusste ja dank dir, dass das erste Triple brutal herausfordernd sein wird – und genauso war es auch- und sich die Qualität dann verändert und hab allein deshalb schon erwartungsfroh das Ende des Monats herbei gesehnt. Die Aussichten, die du zeichnest, sind wunderbar und ermutigend, ich bin -wie immer- ganz still, wenn ich durch dich erahne, welch phantastische Evolution in diesem Moment allem, was ist, geschieht.

    Besonders tief berührt hat mich dein kleiner persönlicher Einblick!
    „Trotz all diesen vielen Ereignissen war die Liebe in unserem Himmel verankert, nichts in unserem Multiversum passiert taumelnd oder unkontrolliert sondern hat immer Sinn.“
    Die Liebe ist in unserem Himmel verankert – was für ein wunderbares Bild und gleichzeitig so wortwörtlich wahrhaftig!
    Nach den Monaten der Trauerarbeit und des damit verbundenen Rückzugs, wünsche ich dir und den deinen von Herzen, dass ihr von den nun anbrandenden Wellen mit Leichtigkeit und Sanftheit in den angekündigten grandiosen Neuanfang gespült werdet!

    Liebe Jada, ich weiß, dass du selten hier liest und so kann es sein, dass du meine Frage gar nicht findest. Schon an anderer Stelle habe ich gelesen, dass im oder ab Januar 2020 etwas Neues „geschieht“. Du selbst sprichst von der Vorbereitung des „Multiversal Events 2020“.
    Ich würde soooo gerne eine Ahnung davon bekommen, was damit gemeint ist, eine Idee dazu haben, worauf sich mein Herz-Geist ausrichten kann, um die größere übergeordnete Perspektive einzunehmen und -wenn möglich- mitzuhelfen!
    Magst du irgendwann etwas dazu sagen? Ich würd mich sehr freuen!

    Jetzt schick ich dir eine liebe Herzensumflügelung und ein großes Dankeschön für deine selbstlose Begleitung!
    Sabine

    Liken

  3. Ihr Lieben, die ihr hier anmerkt, vieles nicht zu verstehen, was auch im letzten Shift bereits unter den Kommentaren zu finden war.
    Vielleicht kommt es nur bei mir so an, aber ich nehme bei einigen einen gewissen Unmut darüber wahr, dass JADA die Zusammenhänge nicht für unser Gehirn erfassbar erklärt – und das macht mich irgendwie traurig….
    Dieses Zusammenspiel, dieses unendlich große Orchester, von dem wir ein winziger Teil sind, ist so multidimensional groß, dass es gar nicht möglich ist das so in Worte zu fassen, dass unser Gehirn all das aufnehmen kann.
    Ich habe so manches Mal lange gebraucht, um mich ein-zu-lesen, ein-zu-fühlen und bei manchen Zusammenhängen bin ich nur noch in die Demut gegangen und habe die Großartigkeit ALL dessen gefühlt….ohne auch nur im Ansatz zu verstehen….

    Ich wünsche euch, dass ihr geduldig mit euch seid und ihr irgendwann in eurem Herzen ermessen könnt, welch Großartigkeit hier beschrieben steht.

    Das sagt euch jemand, der definitiv auch läääääängst nicht alles versteht, aber mein Herz ruft ganz laut:
    JAAAAA ❤️

    Birgit

    Gefällt 1 Person

    1. Schön, wie du das schreibst. Ja das fühle ich genau so. Jedoch kann es ja wahrlich sein, dass die Jada das alles – auch – etwas mehr versteht, als ich es vermöge. Kann ja sein. Und das wollte ich herausfinden. Ich hab diesbezüglich meine Frage an sie gestellt und bin gespannt auf ihre Antwort. Ich vermute sie ist hier im Irdischen mit naturwissenschaftlichen und spirituellen Verstehensgaben gesegnet. Und kann es mir/uns so erklären, was sie da channelt, dass ich/wir es eventuell auch annähernder Weise verstehfühlen können. Und zwar – zusätzlich – zu der Möglichkeit, die du so schön erläutert hast. Lieben Gruß an uns Alle. Di

      Liken

  4. danke jada vieles ist noch unruhig aber wie es sein soll jetzt brauchen wir eine führende liebevolle göttliche mutter vater hand segen segen so sei es in liebe Jutta shorina

    Liken

  5. Von Herzen Dank für deine Durchgaben, liebe Jada. Sie sind so wertvoll!
    Alles Liebe für dein Leben
    und einen wunderbar leichten April

    Sigrun

    Liken

  6. Danke liebe Jada für diesen Raum.
    Der kleine noch getrennte Teil von mir versteht zwar nicht allzu viel, aber braucht er auch nicht.

    Liken

  7. Danke, liebe JADA ❤️….danke für deine wertvolle Begleitung 🙏
    Deine Ausführung über die DNA Sequenzen muss ich noch ein wenig wirken lassen, auf irgendeiner Ebene werde ich das dann verstehen. Klingt für mich sehr spannend.

    Alles Liebe für dich und deine Liebsten und einen sonnigen Herzensgruß an euch ALLE in diesem Raum 🔆💕

    Birgit

    Liken

Kommentare sind geschlossen.